Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257361
Length 568 bp
Fasta Format > whh10c06
gctcctcccccgcatctctctccttttgcccccacctctctccggcgcac ggctccgacgcgatggccgccccactccggcgggtcttcccctccctcgg ccgggccctgctctcgcctacgccggcacggatgctctccgcggaggcct ccgatgccctcgtggagatcaagcccggggagatcggcatggtctccggg atccccgaggagcacctccgccgcaaggttctgatctattcaccagctag gactgcatctcagcaaggttctggcaaagtcgggaggtggaaaatcaatt tcgtgtcaacccaaaagtgggagaacccattgatgggatggacatcgact ggtgatccgtatgctaatgttggtgaagctggacttacgtttgacagtgc cgaatcagcgaaggcatttgctgaaaaacacggatgggaatatgtggtta ggaagcgccatacacctcttctgaagcccaaaacgtacgcagagaacttc aagtggaagggccccccgaagacggaggaagcagcctaagctgtggattt gtatgttgtctggagatt
Download
page-top