Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257360
Length 612 bp
Fasta Format > whh10c05
actgcaggnaattcggcacgaggcaatccacgcacacccgctcccgttcc gtaatctcagcctccgtcctgatccgatccccaaatccctcgcctcgccg cgctcgccgtcgacctcgttctctccggcaccaaatcctacctccggtga ggccgacccacaagcagggcgtgacagcgccctctcgtcgtatctcccgc cgcccctcctctccgcccgccgtcgtccccggtcgccggaacccgacaag ttggatatctaggcggcaccgcagcgttgcggcgcccaccgcgcggacag gatgtctgcggcgccagccgcgtaccccaccagcctccgcgccgtcgcgt ccgggaactccgaggcctccttcttcccctgctcgcaccgcctcaagctc tcctcctcgcatcgttttagtagtagtagtattggtaatcgtagtaattg cctctgacgtttgcctccccctcgttgcccacgaccttcggttcgatctg ctccttgtgctcgtcctgaggattgtctggttgtgagggctctgtgttac atctctgccttttgtgttcgcgcgggtttggtgtctgtgtctgtgttcga tcaccaggtccg
Download
page-top