Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257359
Length 608 bp
Fasta Format > whh10c02
ctcccacgcccgtctccccctagatcaggaggagcacgccgcaccggagc gccgagacctcgaagccttcgtctccacctcggagcagagatggggctca cgttcaccaagctgttcagccgcctcttcgccaagaaggagatgaggatt ctcatggttggtctcgatgccgctggtaagaccaccatcctctacaagct caagctcggagagatcgtcaccaccatcccaaccatcggattcaacgtcg aaactgttgaatacaagaacatcagcttcactgtttgggatgtggggggc caagacaagatcaggcccctgtggaggcactacttccagaatacccaagg gctcatttttgttgttgacagcaatgatagggaacgtgttgttgaggcta gagatgagctccacagaatgctgaatgaggatgagctgcgtgatgctgtg ttgcttgtatttgcaaacaaacaagatcttcctaatgccatgaatgctgc tgaaatcaccgacaagcttggtctgcactccctgcgccagcggcactggt acattcagagcacttgcgcgacgtctggcgaagggttgtacgagggtctt gactggct
Download
page-top