Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257353
Length 659 bp
Fasta Format > whh10b18
gttcatctcaacaggnattagtgcctgcttgcatacggaagtacactgat ggcaatggcaatggcctcttctctgtcggtgctgttgctcctgtgcctgg cggcatcgtcctcggcgcagctttcgcctaggttctacgcgacgtcgtgc cccagggcgctggccatcatcaggaggggtgtggcggccgccgtgaggag tgagcgccgcatgggagcgtcgctgctccggctgcatttccacgactgct ttgtccaagcaagtccctcacgccttctctctttacttactgtagtttct actgcatatactgctgctaatctctccaattcatattaattgtcgttgat ttagtggattagagggagtacttaatttagaaggtctcagtttaaactgt agtcaaagtcattacactatcaataagttagtggcgtggatcactacatg tgtacctaactagtgataagttgacactctttagatcgataatcctagat ctaagaatgactcacctacctacaggttaacataccttcctatatgttct tgttgccccgctacgtaaatcacgtaagttgttttacgcagatgtagcat tactcctctttagactcttcacttgacagtgactttccaatttatttttt tcttggcac
Download
page-top