Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257351
Length 316 bp
Fasta Format > whh10b15
ccatggnacggatcccactcccacgcggccggaggcggcgaggggacgca gaggacgctgaacccctatgtgaccggtaactcggtgattgcaatgaaat acaaggatggtgtgatcatggcatgtgacactggagcctcctatgggtca actctgcgatacaagagtgtggagngggngaaggaggttggtaagcatag tcttattggagggagtggggagttcagtgatttncaggagattctgcggt atctggatgaactgactctgaatgatcatatntggnatgatggnaactca ttgggccccaaggaaa
Download
page-top