Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257350
Length 772 bp
Fasta Format > whh10b14
gcctgaacggaacgaacgaaaaatccccaaccnatctcgtcgccgatcaa ccctaggctcgtcgaatcctcctcccccgccgcctcaagatgcagatctt tgtgaagacattgactggcaagaccatcacccttgaggtcgagtcgtctg acacaatcgacaatgtcaaggccaagatccaggacaaggagggcatccct ccggaccagcagcgtctcattttcgctggcaagcagcttgaggatggcag gacccttgctgactacaacatccagaaggagtccacccttcaccttgtcc tccgccttcgtggaggcatgcagatcttcgtcaagacgttgactggcaag accatcacccttgaggtggagtcgtctgacaccatcgacaacgtcaaggc caagatccaggacaaggagggcattcctccggaccagcagcgcctcatct ttgccggcaagcagctggaggatggccgcacccttgctgactacaacatc cagaaggagtccaccctgcaccttgtcctccgccttaggggaggcatgca gatcttcgtcaagaccctcaccggcaagaccatcacacttgaggtggaat cctccgacaccattgacaacgtcaaggccaagatccaggacaaggagggc attcctccggaccagcagcgcctcatctttgccggcaagcagctggagga tggccgcactcttgctgattacaacatccagaaggagtccaccctacacc tggtgctccgcctncgtggngg
Download
page-top