Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257340
Length 424 bp
Fasta Format > whh10a18
cgctgcgcaccatggccgcgaagctgatgcanaagatccccgccgctgnc cagcgggttcgcgtctcttctcgngctccggcaccggcttttgccgacct cgacccnttcggcccagagtttcgccgggcactggagaagattgtacaag aaacacaggaagaggcgcaggaacgaggccttggcctgtggtgctggctt cagtcttggagcactcacctttttgcttggggtccatcggcttngatgaa gggagatggctcaatggtgaatgactggaatatctatcctgcaccgcatg ttctactatctactactgtgcccgcaagttctactatctactagtgctat atcctgcacnccatatgttctgntatntaccagtactatatcctgnatgt ttaactagccggcgnactctataa
Download
page-top