Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257339
Length 669 bp
Fasta Format > whh10a17
gcgcctccctccctccctcccctgcctgccaacccccaatctcccgtcgc agccctcgaatctcccccgagcatcgaccatgtcggcctactgcggcaag tacaaggatgagctcatcaagaacgctgcctacattggcacccctggcaa gggtatcctcgctgctgatgagtccaccggcaccatcggcaagcgcttcg ccagcatcaatgttgagaacgttgaggacaaccgccgtgccctccgtgag ctcctcttctgcacccctggtgccctccagtacctcagcggtgtgatcct cttcgaggagaccctgtaccagagcaccaagggtggcaagcccttcgtcg acatcctcaaggcgggcaatgtcctccccggaatcaaggtggacaagggt accatcgagcttgctggaaccaacggtgagaccaccacccagggctttga tgaccttggcaagcgctgcgccaagtactatgaggctggtgcccgcttcg ccaagtggcgtgcagtccttaagatcggcgccaccgagccatcacagctc tccatcgaccagaacgctcagggtctggctcgctatgccatcatctgcca ggagaatgggctggtgcccattgttgagcctgagatccttgttgatggac ctcatgacattgaccgctg
Download
page-top