Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208681
Length 655 bp
Fasta Format > wh10e19
tcggcacgagggcagagttgagcgtgtgggagtcgaaggagatcgagatg gcaactgcatatgctcctccgatggcgagccaggtgatgaagagcggctt ggtgagctccaagccgcgggggctgtccggcgcctcactcaccaggaggc cccgcttcgtcgtcaaggccgtcaagtctgacaaggggacgtaccaggtg gtccagcccatcaacggcgacccgttcatcggcagcctggagacgcccgt cacctccagccccctcgtcgcgtggtacctctccaacctccccgcgtacc gcaccgccgtcagcccgctcctccgcggcatcgaggtcggcctcgcccac ggctatctcctcgtcggccccttcgcgctcaccggcccgctccgcaacac gccaattcacggccaggcgggaaccctcggcgccatcggcctcgtctcca tcctcagcgtctgcctcaccatgtacggcgtcgcctccttcaacgagggc gcgccctccaccgcgcccgcgctcacgctcaccggccgcaagaaggaggc cgacaagctgcagactgcggaaggctggtcgcagttcaccggaggcttct tcttcggcggtgtctcgggcgccatctgggcctacttcctcctctacgtg ctcga
Download
page-top