Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ250094
Length 688 bp
Fasta Format > rwhf9b19
agagttgcatcaaagcagcagcatccttagcgaccgaaaacatcatctaa gtgcttaaccaaaacttccacatgcaaaaatcttcaaactcttacacgct aaaacacacaggccagtagagtagggacccgctcacatgaagaggttggg cctcgtcgccttgtaggtggtcttgagcttgcgggtgggtgggcgaacct tctggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtg ttgtccctcttgcacagcttgaagtccaccgtcgcagtcttgatgatctg gatgcagggggcacgcacgcggtgccgcgacgccatctccgtgtacatct gctccaccccgccgttgagggtcgtgtcacggtactccttgtacatgttg tggtaaccggtcctgctctggtacctcagccagatgcccgtagttcttga ttgtggtggggttcttctcaaagatctcgttgatggcgagcatctggccg ttggccttcttcaccttcttgagcttcctcaggaagtaccagaacttgga cttggcgcggacctcattggtggcccagagcttcatgcggtagatcttgg gctgctcatcgccgggggccggcagcgcgcgacccaccacctggttactg gtggaacctgtgggcgaccattctggcgagctctcgag
Download
page-top