Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ255060
Length 452 bp
Fasta Format > rwhf8b01
ctaaacacagnagtcttcttcatgggcaataccaaaacaggacaccttaa gcgcagcaacagtcaccgataacaagcaactaaaaatgtaaagggttcgg gtagtaataacggcagagaccgccctggcgcggccggccggcctagaagc ggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcg agcttggccttggcggccttggcggcgcccaccttcttgtccttggaggt gagggagtcgggcgcgccggaggccacctccttgaggtcgacgtcgaggg tatagcgggtgggcatgagatgggtgaagttgacgagcttgaggaacacc ttgacgcgggacttcttggccgtcttcttggccgagtccttgcggatcac cttcttcgggtacttggccagcccggngacnaggcantgcccgtacggnc gg
Download
page-top