Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ207537
Length 512 bp
Fasta Format > wh4d07
gctccacttcgccttctcctccaagcccgaactccggcgactccaccacc agccccccgagcagcccgccctctccgaccaccgccatgtcgaggcgcgg cgactgggtctacgagaacaacggcgggacctgcgtggccatcgccggcg cggactactgcgtggtcgccgccgacacccgcctctccgtcggatacaac atcctcacgcgcgagcactccaagatctgcgagctggccgataaatgtgt aatagcatcttctggcttccaaggtgacatcaaagctctacagaagaact tagctgccagagaactgctataccagcaccagcacaataaaaggatgagc tgcccagcaatggcacaattgctctccaacaccctgtactacaagagatt cttcccatactatgctttcaacgtgcttggtgggcttgacagtgaaggga aaggatgtgtctactcctatgatgctgttgggtcctatgaaaggactggt tacagtgctcag
Download
page-top