Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208680
Length 524 bp
Fasta Format > wh10e18
gatctgcttgggttggtggagggtatggctatggcgctgcgcaccatggc cgccaagctgaagcagaagatccccgccgctgtccagcgggttcgcgtct cttctcgtgctccggcacctgctgatgctgacttcgaccgcttcggccca gagtttcgccgggcactggacaagattgtagagaaacacaggaagaggcg caggaacgaggccttggcctgtggtgctggcttcagtcttggagcactca cctttttgcttggggtccatcggcttggttgaaggagatggctcaatggt gaatgactggaatatctatcctgcaccgcatgttctactatctactactg cacccgcaagttctacttatctactagtgctatatcctgcaccgcaagtt ctactatctactagtactatatatatcatgcatgttttaactagccggtg tactctgtaattcctggcttgtgtgttatgtaagatcactactgtatgta caatggggatccaggttctgtggg
Download
page-top