Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ253537
Length 604 bp
Fasta Format > rwhf2f15
aaccgataacaagnatacgtttggttncaaaaaacgaagcagcctcactg agttcacttcttatgctcggtggtcactaaccaagcaaaactgacaacca taagtttaattttagaatcgatagctgaagcaacgaaagctctacaccac taagtttctaagaacgaaccaaagtttgaatcatttcacgttgcaagttc cacaaggcaatctcaacatttctgcaacggaagttatgcgggtcgaggct gagcgcttagtcttcctcctcctcgccgtcgtcaccaccaccacctgagg ccttcttctggttcttccgcttcactcttccaggttggccaccacccagg gggctggtgagcgagaagtcgacgtgtttctcagtgtccaccctcaccat gaaagaaggaatgttgacgagctgctttccaaccctgatgtggcgctgtc tgatgaggacacgagcatgatggattgacttggccatgccattcttgaag acgatggtctggagacggcgctggaggaagttgtcaacagtgagggcaag cacgtaatcaagcttgttctgttcctcagtgagaagaccgtagcggttca tgcg
Download
page-top