Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ252605
Length 707 bp
Fasta Format > rwhf25b23
gcagttgatggatctgctgcgcattactaataccaacaaagtcaagagtt gcatcaaagcagcagcatccttagcgaccgaaaacatcatctaagtgctt aaccaaaacttccacatgcaaaaatcttcaaactcttacacgctaaaaca cacaggccagtagagtagggacccgctcacatgaagaggttgggcctcgt cgccttgtaggtggtcttgagcttgcgggtgggtgggcgaaccttctggt acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtcc ctcttgcacagcttgaagtccaccgtcgcagtcttgatgatctggatgca gggggcacgcacgcggtgccgcgacgccatctccgtgtacatctgctcca ccccgccgttgagggtcgtgtcacggtactccttgtacatgttgtggtaa ccggtcctgctctggtacctcagccagatgccgtagttcttgattgtggt ggggttcttctcaaagatctcgttgatggcgagcatctggccgttggcct tcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcg cggacctcattggtggcccagagcttcatgcggtagatcttgggctgctc atcgccgggggccggcagcgcgcgacccaccacctggtactggtggaacc tgtgggc
Download
page-top