Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whcs_6045_c10f
Length 516 bp
Fasta Format > whcs_6045_c10f
TCGCACGGCCTTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCA ACTTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAG AATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCC AAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAG TGACAATAAATAACAATACCGGGCGCATTAGTGTCTGGTAATTGGAATGA GTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGC CAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCA GTTAAAAAGCTCGTAGTTGGACCTTGGGCCGGGTCGGCCGGTCCGCCTCA CGGCGAGCACCGACCTACTCGACCCTTCGGCCGGCATCGCGCTCCTAGCC TTAATTGGCCGGGTCGTGTTTCCGGCATCGTTACTTTGAAGAAATTAGAG TGCTCAAAGCAAGCCA
Download
page-top