Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whcs_8080_b19r
Length 766 bp
Fasta Format > whcs_8080_b19r
CACAATACCGTTACCGTTCCGCCGCGCAGAGAGACGACCATAAATAAAGC TTACACAACATAGCCAACAAGGAGACCGTTCGGACCTGGGGCTGCCGCCG TGGCGCGTGTGCCATGCATCACGATTGCCCAACAACTAGGATTGCAGAAG CCAACATGATGAAAGGATAATGCAGCAAAGACGCACGATGACGAGGTAGC GCAGATTTGATTTGGGACCTTATGTTCTGCCGACCGTAGGGAGGCCCCTT CCTAGATCTTGTCGAGCTTCTCCGCCTTCACCACCGGGTTGGCCTTGGCG ATGGCGTCCATGGCCGCGGCGCGGTAGTCAAACTTGCACTCGTGCTTGTC CGAGTAACGGTGCGTCGCGCAGTACAAGTTCCCGCACCGGCAGTTGAATC CGGTCAGCCCAACCCTCTTTCTGCAGGTGCTGCACCGGCTTGGGCCTTTG GGGTTCTCCATCGCCGCCTCGCTGGGACCGGCGATATCAGCAGGCTGTGC GGTAATAAGCGTCTTCGCCTCAACGTGAGCAACTGCCACCGCCGTGCTGC CAGCAGCAAGGTGTTCTTTCGCGGCATCGCCACCGTTGACGATGCTGTCG AAAGAGGAGGCAGCCAGCTTGGCCTGCTCCTGCTTCATCGCCATCTCCTT GTGGCACTTGGAGCACATGTTCATGGTCGCCGCACTGCCNNAGAATCCGC AGTTATTGACGCAAAGGATGGGACCCTCCNNNNNNTGGCAGCCGGTCTCC TTGTGCTCCATGGCTT
Download
page-top