Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ250785
Length 560 bp
Fasta Format > rwhf17b22
attgcttttatacgagtatacactacattaagagtagcccgtagcatttt tcaaaagacatggatacagccccggcgccatacgggcaaaaatcagcttc atcgataacaccgccaaaaccccaaagagcgggcaggcatcttgatcttg ggtcccaaaaaagcttgctgcccaacctatcttactgttgtgcgcactgc actctttgggcaccgcctccaggcatctcgtcgtcctcatcgtacgcctc ctgagcagcagcatgggctttccgacgcatctcctcctccatgttgacgt catgcattgtcgtctcctcgcattcatcgagctccatgtcggtcagcttg gatgcaggctttggtggaagcacagcctcgagagccttgcactgatccgg tgccagcgagtcgggaaactccaccgtgaaatgaatgtagagcttgccct tcatgaaaggcctctggtacatcggcatcccctcgtcgctgattgccttg aatgaatcaggcttgacaacttcaccagggtttgatttaatgagcagctg cctgttgtcc
Download
page-top