Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ211108
Length 616 bp
Fasta Format > wh37n22
ttctcctccgcctccggtctcgagagctcgccgaatggtcgcccacaggt tcaccagtaccaggtggtgggtcgcgcgctgccggcccccggcgatgagc agcccaagatctaccgcatgaagctctgggccaccaatgaggtccgcgcc aagtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggc caacggccagatgctcgccatcaacgagatctttgagaagaaccccacca caatcaagaactacggcatctggctgaggtaccagagcaggaccggttac cacaacatgtacaaggagtaccgtgacacgaccctcaacggcggggtgga gcagatgtacacggagatggcgtcgcggcaccgcgtgcgtgccccctgca tccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggac aacacgaagcagttccacaactcgaagatcaagttcccgctggtgtacca gaaggttcgcccacccacccgcaagctcaagaccacctacaaggcgacga ggcccaacctcttcatgtgagcgggtccctactctactggcctgtgtgtt ttagcgtgtaagagtt
Download
page-top