Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956240
Length 578 bp
Fasta Format > whchul10f17
ctacattttccagaaactagtacggttctgttccagaaatatctatctaa atctagcacacaagcnagttcgatcaaaccagagtccttctccctcgtca tgcgtagccagncatgncgacgttggcggtggccttgttggtctttttgg cggcctggcgcgncgatttcgtgtagnacatgtagaagtacacgttcang gtcatggtgagcancacaaagaccgcccccganatgaacacccctttccg cagagagtcncaggtccagctccccgcgtatatcatgtgcctgtacttgg tgtggtacgcgttctttgtcgctccngcgatnangcnngactcggcgatt atgaatgtgatccatgaanaaacnaagtagataatggaccangctctgct tccaccgggtgcnagcggntggccaaagcacatgcactttgtaactccca taaggagtgattggcccnanaggagaaacaggaaggcgccgacacnatag ccggtggaaatatcggagtcataagtgcaatatgtggagttgttgatgtc tgtgactatcgaacccgtgctgcggcgg
Download
page-top