Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956238
Length 802 bp
Fasta Format > whchul10f15
atcaggttgcgtgacacacccaacaaccttgaccctttttaacccaactt agcacggccacgaacaacaggtccttcccctccacaacagcaacagcacc agcaatgtgtgtgtatcttgtacatcatatagaaacatcctttgttgggt aaaacaagacaaagtgacgctattgccctagcgacagagggactggaccg actcttgtgtagtatctagcttacagttacaatatcacctcacaacaata cacgacacatcttgggtgctggatgttcctcttctgtccagtcgtttctc ttggcgggcacacaaattattgtcgacggtacacttgacattcatagtat agtacaagagcagcgagtggtcttaggcaacttgttcgtcttcttgtctg gttttgacttcgcggatgatggctggacaacgacatgcattgttataaca gtgctgggaagatcaccaaaaggtgctctgcactgtgcaatattcttgtc attttctagaattttgcctccacttatcagtttcacatcattagcactct ttgggacaattgttttatctttgggccagtcggcaacgacacggtccttg agtgcggcgacggtggtagcagcagcgttgcagcggatggggccgatgtc agagccgtcgaagagccggaacttcacctctacctcctcctcctccgctc cccctcgtgccgaattcggcacgaggganagagagagagagagagagaga gagagagaganananananananananananananananananannnana na
Download
page-top