Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956232
Length 672 bp
Fasta Format > whchul10f06
atgggttcatttcataccagacaacacaagagtggtgcagcaggcgtcag tggaacaagttacagaccacaaaaaatttaatggacaattgagcgagcaa attattgaggcactgttgcaattgtgtgctcgtcttgctggcattcagca ctgaaacttttcagaaacaaaattgtgaaacaagacaggtaatttcgaca agcatcagctaacagtatttataaggcgcgcctcggcatctaattcagac cttatagccggttaaggtgaatcctctgcctgcaatctcgcctatgcaga accatgcataaagctcaaccccaaacagtgttgcaattccaaggtcctcc accctgagctccttcctattcttccaaagctgcttgacaccatcaacctc cttccacaatgcttcatagcggcctggtagactagcgaggcgcgtgtaga agagctgcttggagagctcctggcacttctccacggagggaggctgcacg acgtactgcttgttcttctccatcgcctccttgtagtaggcgccgccgtg cttcgaggcgaattccgccgcctgcgccgccttggtccgcagctgcgcga gcctcgccgccatcgccgccggaaccttgacgaaacgtcggcaagaggcg aggaggaggtgaggtgggagga
Download
page-top