Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956231
Length 559 bp
Fasta Format > whchul10f05
tattgcaccaagtcgttgacacctcaacctcgtccaggcagcggcacgtc ggagggaacgtcctggtgccgacggtccggtcgcagcacgtgcacggcca ctcctcctaggcgcacatgggccctgggtcgccacggtaccagtcgttgc agacgtggttgattccggacggctcgcacagttcgcacgcggcggcgcac tccttcaccttgtccaggcagcggcacaccggcgggagcgactccttgca cacggtgttgttgcagcacgcccacggcttctctgcttcgagggcgccgc cagcgctctccgtcggcgccactactttgtcaggaggcgtctgctcctcg cctcccttgttcgttgcaagaccatcgccgccgtcgctggggaggcggat ggtgtccgcgtcaacgccgtcggcggcgacgagatgggccgccgccggga gcgagagcatcaacacgaggatagctgcagcgcgtcccgttcaatactat tcaaattatgaattgaactggttccagagcgaccagacatagcaatcact ttgctgtgg
Download
page-top