Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956219
Length 758 bp
Fasta Format > whchul10e15
agcagcaactattgggacttcaaccagagcttgttattattacaaagttc gacagaaagctacggtgattgcaagccaacagccatgctacagcatgtta caccagggtacccagcaaaccacgttttgctcaatctttacccacttctc caggagtgtccaccttggccacagcggatgcgtagctgacgctgctgtcc ctcgtggtcttgcattggctcgactgctcgtagcgaacaaacccgacctt aatcttcgtcgagcagtgtttcaacatatgaagaaggacgctgatgggat ggcgtccacatatggtgttctcgtactcctcgagatactgtttgaacgca tcggggtcaccagtctctatgatctccatgcccaagcggtccaacgcctc gattgatttgtgaatggcaccatgcttcttgtcatagtatgtataactaa accgagatccccagtggcaaaagtctgaggagacagaaaaaaagttcttt ggatcatccacatatttagcgagcaactgcccatacatggcttcattttg ggagttgacggcaccaacaaggataggtacaacttttacattatgtccct gaaatacctttagaaaggtaaggcaaatgcatttccatgctatgttcagc ctcatccacattaaggtccataaattcaaattttccggtagctttgagtt cctcgataacttccaggtctactggtaaatccccaatcggggtgctataa cagtagct
Download
page-top