Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956215
Length 703 bp
Fasta Format > whchul10e10
acaagccatctaacgatggtgctccttacaaagtttcaacacaagggtaa caagcatacacgcagagaggtgggctatgctagattttccgtatactcag agcgcgcaagctggtaacgcctgcttgcgctagcacacaactaaatatac tgcaccaccaatatatagctgctttgcatgtagactctgatatggagctg gcagttgttcagaaaccatgaatcttgatgtgttccttcttcacaatgcc ggcctggacaaggaagtttgagacgttcttcctctgatcaccctggagtt gaatgacctgtccaagttctgtgtcctggacaactgtaccattgcagcaa aactctttcttgaggtctttgaggatcttgctgtagctgaactccttctt caggccctggacagtggtcaggctcttgcgaccattacgctgctggatgc gtacatgaacgtagtcttttgatccggcagctgcaccagcgtccccagca ttcgcctcggcaaaggggtcaaaggcagttgggatctgaacgtcaagatc agacatgaaatctcctggtgagagtggcaaaagctacaccaagaacctgg gaggcggtcgaggaggaagagatcaaccaagaactttcccgggaggattt ggatcgcggagaggcgctggcagtcagtccttggtgttcttcctcctctt tgg
Download
page-top