Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956212
Length 752 bp
Fasta Format > whchul10e07
acattaactctaggttctcgatgctcaaggggttcaaatagaaacataaa tacaaactgagcgataaaaatgaactgagaaaatcgctagtggatactta attagctagaaatacaatgtagcactagccccttccttccatccttcttc tatgcattcttactagcgccggcaatggatcttgctgctttcaggttcag aaacactgcccagcatgatgcaacggagctggcgaaaagaactcggagct ggagtggcatgtactcatagttgatccagctaactattggccagaacttc caagctgtcaattggatgtttgcaaagtccttcttgaccttgctctttac ttgcccgaatggcctcccttcaactaccagaccgtagtacatcatgaaca tcatattgttccatggtgatacagttagctgctccactatgaccttcttg gctgtagtttcttttcctttcttctgtcccttgaaaatcttgtccataag cttgtggaaaaaatgaccgaatggtcctgcgtatgcaaatccatagagca ttatgaggaggagcctcctgagctggagcctcttgacgccggagatcttc tgggcgacggcgtcgctgcagcccgccagcaccccggaggtgatggcctt ggtgcggagagggtgcttggagagctgtctcatgtacgcctgccccgcca tcgccgccacctcagacatcccgcgcggagagatggatctgatcccggcg ct
Download
page-top