Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956211
Length 655 bp
Fasta Format > whchul10e06
agaatgttgacaattacattatttttttttctgagcatcagggtcttcca tgctgtgaaattctaccatgtctttgctacacattagtacattcggaatt tctccttggtgttctcaaagacttgttcagcaagcagggctccattccca tctgctcgcttgatctccatgttggccttctggtagaacccggttcctct cagagcatcagcgatgaagtcgtcgaatccaatggcaatagcagcttccg ccttggctccgtacaccagcctcttgatccgggatagatgaacagcccca aaacacattgggcaaggctcacatgaggcgtacatttcgcaatccgacag ctcaatcttcccaagctttttgcaagcctctcttattgcagtgacttcag catgggcagttggatcggtgttgttcaaaaccatgttatggcacccaact attacttcgtcgttgcggacgacaaccgcgccaaaggggcctccatggcc acagtcaactcctttgtaagcctcttctaccgctttcgacaagaacttgt gatccctatcttgtaccgcttcctgatgaccgggaaacgctgaagcaact gcgatagtcccatccctggtctccacaaccttggcttcctccatggcggg cgagc
Download
page-top