Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956210
Length 753 bp
Fasta Format > whchul10e04
cattacatctagcagcaaccacgagttcgcaaatcaacaaacatcaggca aaacttaaaaacgacggttccaggaacataggtctatatccttgaagata actggctatagcaaaacgactcaacgcctcagaatcaggccttggcagca gcctgggcagcagcatcccgcttcctctgctcctcaatgatggtgagctt gatacccttgcccttggggaggctcacccacggcttggtgcccttgccga tggtgaacacgttgcccagacgggtggcaaactggtggccctgcgcatcc tcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgat cacaccaacacgcccagtgttgcgcccaccagtcaccatgaccacgttgc cgacgtcaaacttgatgaagtcgacaatcttgttggtctccaggtcgagc ttgatggtgtcattggccttgatgagtgggtctgggtagcggatggtgcg gccatcataggtgttcaggtaggggatgcccttctggccgaactggacag acctgaccttgcagagcttgaacttagcatcctcatccctgacagagtga aggcggaagcgacccttggtgtcataaagaagcctgtagttctcaccagt cttgggaatggaaatgatgtccatgaacccagcagggtaggtcttgtcag tgcggacctttccatcaaccatgatatgacgctgcataaggatagattgc act
Download
page-top