Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956207
Length 468 bp
Fasta Format > whchul10e01
ggnntcaggcttgnnatctggcttaggcataggttcaggcttaggctctg gtttaggcaatggtttgggcttaagctctggctttggcatcggctcaggc ttgggctctggcttcggttctggcttcggcattggctcgggctagggctc gggctttggttccggctttggcatcggctctggcttgggctcgggtttgg gctctggctttggttccggctttggcatcggctcgggtttgggctctggc tttggttctggtttgggcatcggctcgggtttgggctcaggcttaggctc aggtttgggcattgggtaaggcttgggctcaggctttggttccggttttg gcatcggctcgggcttgggctcgggcttgggctccggttttggcatcggc tcaggcttgggctcaggcttgggttccggttttggcatcggctcaggctt gggctctggcttangtnc
Download
page-top