Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956206
Length 530 bp
Fasta Format > whchul10d23
gccaattggttgctcccttcttattctgcatctacacaggcgccaaaata ctcgaaacaaaatggaaacatattcgtcatgcatgtatttatgagctaca gatctctatcactcagcaagggtagaacaagttgactaacttcgacaaaa gttatatctatgcgatccagcggtccatttcagtgctcctttggctgaac atacttctctcagaatgaaaacatatttttgttgtccatttcagtgatcc tttggcttgtccttgggaacctctgtatccagcttcttgggaggtggaac tgcttcttttgcagacttggatgcggcggaggcgttgtcctcctcgagcc actgtcggatttggcgggcgttgcggcggaagacagcaccggacttgcgg acgtcggtggtgaagagaagcagcgccccgcccaccaccgccgccgtcac gatgaagttggtgagcgccatctccgtctctcgctctcgccggtccggtc tgtcgtggcggcggccggactggaattccc
Download
page-top