Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956205
Length 707 bp
Fasta Format > whchul10d22
aacatatcaccggtacaggtaacatatatgttacagttatgtcgtacaaa ttgatcttcagaattcagaaacatcacaggctcctcttccagcatgcata cagtccagacaacataaagcataaagcagcatcatttcatgtacctatgc agaaacttgcggtgaaaatcacttctgatggtgtcgttgatgaaccgttt cggtgtcttagtctctccacgagcttggttcttgaatacaacatcatcat cccaccttctcttcacattgaaggagccagagttattcatattgatcagt gggtttcctcgcatcagctcagcctccttcatcttggcctcttcttctgc ttgctgacgctcctttctaaacctgtcctcagctctttcttttttaatcc tttcgagctctgccatgagtgcctcagtgtcatcgtcatcgtcgtcatca tcgctttcatcatcacttttgagctccacgtcagagtcatctgcatcaat ttcacgtggaactatcttatcctcatcccgttttgaaccttctaagagca ggctcgaactttttcgtcggtccctctcatcaacataggacttatccttg gatgagaagtgcttgcgctcacgctcctcaagttcgtccctgagattcct cttctgtacctcctcttgagtttgctggccctcttttctgggcttgangg aggtgtg
Download
page-top