Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956204
Length 705 bp
Fasta Format > whchul10d21
tatctttatatattaacaaaacatgcccagcaatcgcttggatgcgatgc ggtacttaggtacaaaggataaaacatcagatattaaattggcatgctta aaaggtgtaaaggcagctgccgtcgtcactcctcgccgttgggtcgaagt tcttggcagtctggtcggtgcatcctgccggtacaggcaaagtaccttgc tgtgcccctttacctcctcctatgcagcaagagatggtgggtgtgtatgg agaatgttctaaccgtagaaggtaccagtcttcatcgcatcctggttagc atcacccagagctgcctggctcatgtaggtgtcagcaagctgcacacgct tgacattgtcctgctcctggacgagcatgtgcccgtactctagcagcttc tccactgtcatctttggctgctcaaaggtcactggtccgtcccgcgagtt caccagcttcttgccaatgttctcgataccggtagaggtcacccacttgc gcacctcgtcgtcgtacacccgagcacgcagagcaccgaaaaagtcgatg gattgtcctgggaaggtgtcgacgatcttgacgacggactcgtcgctgac attgtcggtctggaagatacccttgcagacaccgatacggtcgtcgcggg tgggagcccagtanaacttctccatacgaccatcacggatcanaggggcg tacaa
Download
page-top