Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956202
Length 770 bp
Fasta Format > whchul10d17
aaagttcagcatccagatatacacggacgccacagcctccatactttacg acaaaacttagcccactggagaattatacagtccagttactaaccattgg cagggacttcatggtccgggaaactcgacgtgtcctcagtgtgcactgaa tctctatggatcctcttctgcaggttctccaggctcgcgacgcgttgcaa aggggctggccttgaggtcatctcttccccattgggcaaaggggttgcta cctctgagaggtcatgtttgatcagattgtcttcaagtaaaccctggagg aaatggctcatgttttcctcagtgggaacagcatcagcagaagctgcaac agatacacatgaagacaagggcacgttgtttgatgtagtggagaacatca agcttgctccagttactctcctgacagcttcttcagctatattcacacac aagcattaacaaatgtatgtatgattgtgcctgtttggactcctcaggtg cggtatgagatagaacaccctcccataaggaccaaaaccacaggcttaat gagacacactctctgagcattgcaacatggtatgagcgcttttttatatt ttgtttcgtttttacaacacccacacctgtaagaaaacattgttattctt gacaccaaaaaaataaaaagaataggagagtgaaacatagaactaaacta ctccttgttcactaatggaagagaatagtacctgcctgcctccttatgag antggcaanctcaaacccag
Download
page-top