Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956201
Length 764 bp
Fasta Format > whchul10d15
gccacaagactatacatgcgacctcagtctgatgtctgcagtcaaaaacg gggcaaggaacgggatacaacagagcagtgatgccacgacagacgatgaa tgaatcgatagatgtatcagcaaagcgaggccttgccggagaggtggagc agcgcacacttgtggtgtgcagcacggagcttcttgtacttctgcacgaa ggtcggcaggtcaacgtccttctccaggaacttttggtgcagctcctccg actcctcgtccagcttcgccattgtactttgcagcttgtcgagcagcgca gcaggagaataggacttcataatctcgtccttttgcctttccaactcggc caacctgtcctcagcggcagctagctctgtggttctgattatagtacact gattcctgagctctgaaatccgctgctccttttctaaattttctctcgca agctgcagggtctcctttctaagctcatcgcgtaaattgttctgtgtttt aacttggtcaagtgaattgaaaaaagcattatatgactctttgtccttta acagcctctgcagctcatcaacactcttatccctcaaacgagcaattatc cctgcagcttcagctggagacggttggccacgtgatgaaggctgaggatg atctgaagctctttggtgtggactagcaccggaagagctgggtgtggatg gatgtgaagatgaaccacctaccgagggagggtaccaagattgcgtaaat atgttctggaaant
Download
page-top