Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956195
Length 476 bp
Fasta Format > whchul10d06
agcacaccagaaggcattcacatcaactggtgaagtgacgttcaggatag caacaccagctgtttgcagcgagtggtcacgaacccagaaacattattcc cgttttttgtcaaatctcactggagtaaactacttttactccgatacttg tccccgtaagatagattgcggggttacggaaaaacctgggcagctttgcc catcatcagctaaacaattctcaaccattagaagtttgagatgcttgtgt aggctctcagacgtactgaaccccctcgccctggatcacctctccgatgc ggtaagccggacttgattcttccaggattctgtccgccgcatccttgctt actacaaggaccatcccgacgcccatgttgaacgttcgcagcatctcagc atcttcgattttgccaacctgttgaagccactcgaacacaggcagcactt gccacgacccggtgacaattttcgcc
Download
page-top