Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956194
Length 858 bp
Fasta Format > whchul10d05
gcaacttcgtaaaccaaacacgtaacagtgactcgatagttcattaaacc aacataggactgatgcgaacaatgaaacagttcaaatgaaacggacacaa cgaacgaccaagcataaaccagcaggtccaacgccagggcaattactgac caccacgcagacgcaggacaaggtggagggtggactccttctggatgttg tagtccgcgagggtgcggccatcctccagctgcttgcctgcgaagataag gcgctgctggtccgggggaatgccctccttgtcctggatcttggccttga cgttgtcgatggtgtcagaagactccacctcaagcgtgatggtcttgccg gtgagggtcttgacgaagatctgcatgcctccccgaaggcggaggacaag gtgaagggtggactccttctggatgttgtagtcagcaagggtacggccat cctccagctgcttgccagcaaagataaggcgctgctggtccgggggaatg ccctccttgtcctggatcttggccttgacattgtcaatggtgtcagacga ctccacctcaagtgtgacggtcttgccggtgagggtcttcnacgaagatc tgcatgccaccacgcanacgcaggacaaggtggagggtggactccttctg gatgttgtagtcagcgagggtgcgaccatcctccagctgcttgccagcaa anatgaggcgctgctggtccggagnaatgccctccttgtcctggatcttg gccttgacgttgtcaatggtgtcnganctctcanctcanggtgatggtct ngcngtgaggtctttgacaaaanctgcatgccacncncancncagganag ntgaaggg
Download
page-top