Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956193
Length 661 bp
Fasta Format > whchul10d04
caacctatggttcgtacaaacacagatcataccgaaggaaaaatatgctc tggtcgggaagcagagtcctggacaaaagtgaagttcacaaaagacaatc atacataggccattgttttaactcgtagtttaggccttgccagactcctc gcaacccggtggcctgaatgcgatgaagctgacgcactgcacctggcgca ggttgtcgaagccgatgacgcggacataggcgtcagggtactccttcttg acctcctccacctcgttgagcacctgcgtggcgtcggtgcacccgaacat aggcagcttccacattgtccagtatcgaccgtcgtagtacccggaggagc tgttgtgctcacggaagacgaagccaaccttgctgaactcgaggcagggc acccacttggagcggatcaggtagtcgacctgcttcaggagggcctccgt ggagaggggtggcaagtaagacagggtctcgaacttcttgatgccctcaa tcggccacacctgcatgcacctgatccttccgccattgctgacgcggccg aggctgccgctggagcggcggctgacggggagaccggctgtggacttgag cccctggaagggtgcgacggtggtagccgacgaagccatcacggcggggg ccatggtattg
Download
page-top