Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956192
Length 853 bp
Fasta Format > whchul10d03
cagcaacttcgtaaaccaaacacgtaacagtgactcgatagttcattaaa ccaacataggactgatgcgaacaatgaaacagttcaaatgaaacggacac aacgaacgaccaagcataaaccagcaggtccaacgccagggcaattactg accaccacgcagacgcaggacaaggtggagggtggactccttctggatgt tgtagtccgcgagggtgcggccatcctccagctgcttgcctgcgaagata aggcgctgctggtccgggggaatgccctccttgtcctggatcttggcctt gacgttgtcgatggtgtcagaagactccacctcaagcgtgatggtcttgc cggtgagggtcttgacgaagatctgcatgcctccccgaaggcggaggaca aggtgaagggtggactccttctggatgttgtagtcagcaagggtacggcc atcctccagctgcttgccagcaaagataaggcgctgctggtccgggggaa tgccctccttgtcctggatcttggccttgacattgtcaatggtgtcagac gactccacctcaagtgtgacggtcttgccggtgagggtcttncacgaana tctgcatgccaccacgcanacgcaggacaaggtggagggtggactccttc tggatgttgtagtcagcgagggtgcgaccatcctccagctgcttgccagc aaanatgangcgctgctggtccngagnaatgccntccttgtcntggatct ggncttgacnttgtcattggtgtcngaactcncaacntcanggtgatgnt cttgcngtgaggtcttnganaaaanttgcatgccncncncancncaggan ang
Download
page-top