Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956189
Length 430 bp
Fasta Format > whchul10c22
attgcatntaacttgaactttcanagaacaannaaacagcnaaaatgttg caaaggccatgggtagtgcttctaggtacatggatcgctatctgctagga caagccctatgtatgttctgtanaatcntatataagaaattaatcacaac aaaatggtatctccaaggctattaccacaactgcaacaacaacccancan aanacaaagaatgttgactgcacactaatacatacnagaaacagaggctc gggcaaacanaacagaacccgtcacgcgcaaaacttatccaaagggcgag gcgacagggccagcgccggcgagggcgtcngaccgcttgatgctgcccat gccgcanatgatgcagcctggggccgagagggcggagaacttggcgccgc agaggtcgcaaacgtcntggccgatggtgg
Download
page-top