Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956183
Length 764 bp
Fasta Format > whchul10c15
gttcatcatagggaagctgggatcagcagactcgtctatatactcaaccc aaacaacaaagttttgagtcaaggatcccgttactacggaatgaccaagc aagaatcaatagtatcttcttacaacgatggactgaaaagaaaagaaaag agaatactcatttccacaattgcttcttttccaactcaataaatgagctg agatattgtacagccgaggaatccagaagaaaataaaactttccgttggg aaagtcaaaacaagggatgagcagagaaatgctacccgaataattcgtgt tttcaatccagacgttgctcccctaaagctcttgtcgatatatcagtttg tccatgaggcggaccttctcaaaactggcttcattgccttgtcctcttcc aaggctatcataccaagatgcgaaggatcctccagcagcatcttggcgac caaatacccggcaatggaccaagtctgaaatttccttgcctgcttgccaa catattttccaagcttaccatcgtaatactcaggccagccatccttcaac agcctcctctcagctaggtcaattgctcttcttgcaatttgcggccgtcc agttttgatgcttgctgctgtgagcagccagagaagtactggccaagatc ctccattgtggtaactccatctcgtatttttttggatcacatcccgtcac gatacgccattcatggttctcaatagcaggatagcatatcttcagaggca tctcaccaattaac
Download
page-top