Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956180
Length 441 bp
Fasta Format > whchul10c12
acatacataacagatccacacatggatacatttccgcaaaacaccaacaa tacttatttttcttcacaacatacccatgcttatttgttcggcaaattaa ctggacgatgttgagacttgcatgggcttttattccagttggctaattac aagctagcttagccaatcttgggaacctccgccactgtgtcgacccagac gcggacgcggttcagatcgacctcctgtgtcacaacacttcctaccggga caatgacaactttgaggtccggtcggtccgccttgatcttctcctccgcc tccttgatcgtgcgcccgaccagctcaggccactccgtcttgggattggc accgtcgcatggcttgctcatggtgggaatgaaattgggcaaacgccacg acctctatgcacttctatgtgatttgatcgttcctacctcg
Download
page-top