Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956178
Length 752 bp
Fasta Format > whchul10c08
tatctttgataaccatatgtgaatcattttctacacactgaacaatcagt acagccgcgctggacatgacccataagtccgaaatgtgcatacagtatct gtactgtaacaacagacaacgtaccacatctttactgtaacacaccagaa accacactgcctctctacagttgtacagtacacacaagttttgatactgt gaacattggacaccaaaagaaggcggcacacacatggcataaaatgcaac taattccccaaccattcgaagcaacgacagaggccccagcaaaacctcga agggtagttccgcacgaaaacatccctgccgtagccaacgacgtagaaga taaaagatcgcttacggtgcgacattgtgacacgggttacaggcacgacc gagatgatgtgtctctccgaaatgactattgcggatggtggaactggcag ccggctagcaacaacctccgaggacaactggttgagtgggtatgaatcgg caaagaaagcaggagtgcattggtatgcctgtatgttgcatagttgcacc ccttgcgctctgtggaaaacttcatcagggaccgtagcagtttctgctgt tgcactaacttttctcgctgtaagcgtctcccatcgaacgcgagcaatgc tttgtgtaagaagggaacagcagccattacatgtccggcatgttactagg ccacgggatccacattctgtgcagggcancactccttgacnattgcacat cc
Download
page-top