Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956174
Length 814 bp
Fasta Format > whchul10c04
tcacacacacacttcagttacaacatcacgaggaggtaattttcctccag ccaatctaactcggtaaaacttgtatagctgcgctgtgcaagcagcgtcc taaatggtaacgaacacggtatacggaacacattacaagccttcttgctc tggatgaaggctgatctaaccatgtacaacactacagttacaggtaaacc gcgacaacgatacacacagactcccgctctccgacaattatctgacaaca ttccattcttcccttcagaactgttatgtatgtagcttcccaatgagggg ctgactgcactgaacactgatgagtcactatcaacttaactaccgggcaa tgtctcgaaaaattgggagtccatgatgctctgttggctggctgtcccga ggtataatgtatgtaccttgcaactggcaaagaaatttctgacgagaaac atacagggtcaagaagatggagggggtcggctatgtatcatatgtaagca agagagttcctgtcaccagcagaatgcggccgtcctctagttggtgtagg tggccgttgtatgttaagttcctgcatccatgtggcatccatggcacgtt caggggatgactcaggagaattaacaggtggtggaagtggatgaattaac ttagggacaataactagtccccttcccaccacaagtatggcaccagcatt atttgcagtgccacaataattagtggctgaaaataaagtgatcaactgcc natgggcgaaacgctcaatccatccataacacactcatgagctcttatga tcaactgcatttgt
Download
page-top