Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956172
Length 664 bp
Fasta Format > whchul10c02
acatggacggaaagagtaaccaaccatctaggtacaagcaggggagcacc cggcggcagaggacatacaccctccgccgccagggcaccacccccgccgg cggcggcgccaacagggagcgctgtccgttatagcaggcagcgggacgac gacaagaaaaaaaaggtaaaacaacatcacgatgtgaagtgaaacttggg ataactctagtggagatggacaggctccttatgacaccaccgcacacagc tcacgtcggttctcgcgcagcagccgctcccgcctttgtccgccggagcc agcagccttgacaagatgcgtcttcttcactcgtcgtcgtcctcgtcctc atcgctaccctcatcatcgtcgtcgtcattgatctccgacttggacttgt cggactcctcctcatcttcctcctccacctccttggccaccgccttcttt ggggcagcagcagcagcgctctcgcccttgttgtaggcggcaatggcctt gttgtactcgcccttgagcttgttggccttggccacgtagggggccttct ccgattcgctcaagctcttccacctctcaccggccgctttgccgacggcg gcgacggacttgttcttggggttcttctgcttgaactcctcgcggaactc gcccatgaagacga
Download
page-top