Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956171
Length 719 bp
Fasta Format > whchul10c01
atttcgcaaaccaacacgttaacagtgattcggtagttcattaaacccaa cataggactgacgcgaacaaaaaactgttcaaatgagcggacacaacgga cgaccaaggataaaccagcaggtccaacgccagggcaattactgaccacc acggaggcggagcacaaggtggagggtggactccttctgaatgttgtagt ccgcgagggtgcggccatcctccagctgcttgccagcgaagatcagacgc tgttggtccggggggatgccctccttgtcctggatcttggccttgacatt gtcgatggtgtcagagctctcaacctccagagtgatggtcttccccgtca gggtcttcacgaagatttgcatgccaccacggagacncaggacaaggtga agggtggactccttctggatgttgtagtccgcaagggtgcggccatcctc cagctgcttgcctgcgaagataaggcgctgctggtccgggggaatgccct ccttgtcctggatcttggccttgacgttgtcgatggtgtcagacgactcc acctcaagcgtgatggtcttgccggtgagggtcttgacgaagatctgcat gcctccccgaagacggangaacaaggtgaagggtggactccttctggatg ttgtagtcagcaagggtgcgaccatcctccagctgctngccagcaaagat aaggcgttgctggtccggg
Download
page-top