Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956168
Length 743 bp
Fasta Format > whchul10b21
gaatatttatgtggttcgcaacagggtagaaataaacaaaatacaggaca ccttgatcacacgtgacgatcctcacatacagattacaacagagatcgaa caacttgtacgttggtgactctgggcagtttgtgagtgagaagggcgaca tctgccaagttgtgtatcgtacattaccaaatggactattatacacatgt cagcacatcgattctcttttacgacctcactttggcgagcctttctctta tcttctctagatcatcgtcgtcgtcgtcaacggattccgctacagcagtt ctctgtgcagattcgcttgtcgaaggttgtgtgaccttctctttttgttt gcggacagcgtcaggaagctgggacgcagtctccccggcgattgcagaaa ggaccttatcaacctcctcctcgatctcctcctccatgccctcatcgtcc agtgctgaatccatggcatcattgaccatttcttccatcacgccggcctt tgtcatctctttactgaattcctgcatggtgactgctatttctggggcct tcataagattattgacaagtttcattacttcagtgctcttggacaaatgt cctactgttctagtagtagcgacgatctcgccgaggtgcatggagatgga gttgagctgggccttgttctcgtagaggcggttgaccgccttcctcgact gcaccagctcccttggccagcgccttggcggatcccatgtcgc
Download
page-top