Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956167
Length 620 bp
Fasta Format > whchul10b20
tnattntggcagcatcaggagtacatctgacggaaatcgtccagtctttt cctccccgttcgacatttcttcagctcctctgttttcttgcggataacat taacgaaacgtgtgtctactctgtgacggatactataatcaagtatactt aggacgagcgaacaatcgtgaaagtacaacaccaccaaaccaaaatgctg gaagtccaaactccagagcacgtacgtcgctgctctagaacactctgggc ttggcgacgatggtggagtgcttgaggatgtggaggctgaactggccgcc cttctccgtggtgtcgagcttgtcctggccgggcggcggcgtgagcacga agttctggacgaggcggccgatggtgatgccgaggatgggcagcgcgagg atgatgccggggcagctccggcggccgacgccgaagggcaagtacctgaa gtcgttgccgttggcctccacgtgcttctcctcctccaggaagcgctccg gccggaactcgtcgggccgcttccactgctccgggttgttggcgaggaac caggcgttgacgaggatcttgctctcggcggggatgttgtagccggcgag cttggcgtcgtggaggttca
Download
page-top