Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956166
Length 705 bp
Fasta Format > whchul10b19
acttatcaataggtatctaccggctcgaactcgaatttgatcgccttcca tacttcacaagctgcggctagttcaggactccatttgcaagctgctcgga taatttcattaccttcgcgagcaagatcgcgcccttcgttacgagcttgt acacaggcttctaaagccactcgattagctgctgcaccaggtgcatttcc ccaaggatgtcctaaagttcctccaccaaattgtantacagaatcgtccc caaagatttcggtcagagctggcatatgccanacatgaataccacctgaa gctaccggtataacacctggcatggatacccagtcctgagtgaaaaagat accgcgagcacgatctttttcaataaaatcatcgcgcaataaatcaacaa aacctaaagtcatttcgcgttccccttctaacttacctactactgtaccg gagtggatatgatctcccccagacatacgcaatgctttagctaatacacg gaaatgcataccatgatttttctgtctatcantaactgcatgcattgcac ggtgaatgtgaagaagtangccattgtcgcggcaataatgagccaaagta gtatttgcggtgaatcccccagttaagtagtcatgcattacaataggaac ccctaattctcttgcaaatacagctctcttaatcatttcttcacatgtac ccgca
Download
page-top