Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956160
Length 756 bp
Fasta Format > whchul10b06
attcactctaccaggaaccaacggaacgctgacagattgtacgactccaa acacaaccattcactttgcatgaacagtcacatggtactaagcataaacg taactgaagttgccaatgcataacgtctgaaccaacaaagcagtatcccc acgtgattagcctaagaccagcacgtcaggatgtggcgaagtagtcgcat caagtcagattggaactagagtccttcgaccatccgccatgctcctggat gatatgtgtgcatgaactatgacttcatcttctgctctaactgcttatcc tctgaaagaaatagaggtatcccatgtccttgggcaggtcgaccgatgca gcaaccttattgtcgttgaagatcgtccacctcccatctttgaggatatg ggcgacatagtgcccacagtgtgtagaggttcccatgtggctcacaaatg ccatcagcttgtatctgccacttccatctgatatgttcgagtcgtcatct tttacattgtttgttgaagaatcagcagatacagaactagatgcttcagg gtggctgaaaacccactccgtggctctctcaatatttccaccagaagctt tcaaggccattcgagaaacatcttctggaaagccaaaggaaacaagggtt tgaagacttgcttcatcaatagtgtcttctgcaggcattggatcttgaga tatcggctcattaatatctggatcccccgtgtgtgagaggagccaatcca ttgcct
Download
page-top