Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956154
Length 704 bp
Fasta Format > whchul10a21
agcacaatagcagcttacacgcctcaactagaatcctgcacttgacaggt cactcaacaaggcaatagtaatatatcgacccacactaatgtctgacggc aaaccaacagatactcaacataggagcaaactaacgacacaagaatgaaa aggtaaaatgacgcttgcggttccactactcgcggtttcatcacttctcc tccctctcacggttccactgctcgatcttggccctgcgctcctcactgtt ctcccttgcaggagggctccttccacgtcgtggcgggctgccaccatacc tgcgcctcggtccatcatcatacctatcatgcctgccaccacctcctctg ccgccaccacggtaaccgccgccgccaccaccacgatagccgcccccatc acctccacggtagcnacnaccaccgcctccacagtaaccgccaccatcac ctccatcgcctccacggtaaccgccaccgccgccgccgccacggtattca tcccggccatcacggcggangtcaccaccacggtcacggttgtccctcct gtgctgtgggcttgggctgcggctcctcccgtggctcctcctggaccgcc ccccatatagcttcctcctgagctccctgccaatctgcttcacgtgcatg aagttgcagtagccgccacggttgcagctgttctcctcaaactgcctgca ggtc
Download
page-top